-
PurposeTemperature sensitive plasmid for either lambda Red recombinase genes or flippase recombinase expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepkd46
-
Backbone manufacturerDatsenko and Wanner, 2000
- Backbone size w/o insert (bp) 6330
- Total vector size (bp) 9647
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsTemperature sensitive origin.
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameflp recombinase
-
Insert Size (bp)1272
-
GenBank IDAF048702.1
- Promoter rhamnose
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tatgtcgtgattgagcggga
- 3′ sequencing primer caccacaattcagcaaattgtg
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerhaS
-
SpeciesE. coli
-
Insert Size (bp)837
- Promoter rhamnose
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctcctcaatttcattacgaccag
- 3′ sequencing primer GTCCGTTATGTAGGTAGGAATCT
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namerhaR
-
SpeciesE. coli
-
Insert Size (bp)849
- Promoter rhamnose
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ttaagcagcaaacgggactg
- 3′ sequencing primer TCAGATTCCTACCTACATAACGGAC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIJ8 was a gift from Alex Nielsen (Addgene plasmid # 68122 ; http://n2t.net/addgene:68122 ; RRID:Addgene_68122) -
For your References section:
Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress. Jensen SI, Lennen RM, Herrgard MJ, Nielsen AT. Sci Rep. 2015 Dec 8;5:17874. doi: 10.1038/srep17874. 10.1038/srep17874 PubMed 26643270