Skip to main content

pSIJ8
(Plasmid #68122)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68122 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pkd46
  • Backbone manufacturer
    Datsenko and Wanner, 2000
  • Backbone size w/o insert (bp) 6330
  • Total vector size (bp) 9647
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Temperature sensitive origin.
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    flp recombinase
  • Insert Size (bp)
    1272
  • GenBank ID
    AF048702.1
  • Promoter rhamnose

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tatgtcgtgattgagcggga
  • 3′ sequencing primer caccacaattcagcaaattgtg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    rhaS
  • Species
    E. coli
  • Insert Size (bp)
    837
  • Promoter rhamnose

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ctcctcaatttcattacgaccag
  • 3′ sequencing primer GTCCGTTATGTAGGTAGGAATCT
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    rhaR
  • Species
    E. coli
  • Insert Size (bp)
    849
  • Promoter rhamnose

Cloning Information for Gene/Insert 3

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ttaagcagcaaacgggactg
  • 3′ sequencing primer TCAGATTCCTACCTACATAACGGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIJ8 was a gift from Alex Nielsen (Addgene plasmid # 68122 ; http://n2t.net/addgene:68122 ; RRID:Addgene_68122)
  • For your References section:

    Seven gene deletions in seven days: Fast generation of Escherichia coli strains tolerant to acetate and osmotic stress. Jensen SI, Lennen RM, Herrgard MJ, Nielsen AT. Sci Rep. 2015 Dec 8;5:17874. doi: 10.1038/srep17874. 10.1038/srep17874 PubMed 26643270