Skip to main content

pCXLE-dCas9VP192-T2A-EGFP
(Plasmid #69536)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 69536 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCXLE
  • Total vector size (bp) 15848
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-dCas9VP192-EGFP
  • Insert Size (bp)
    6802
  • Promoter CAG
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site ClaI (unknown if destroyed)
  • 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    dCas9 Mutated from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Addgene Plasmid #42335; pCXLE backbone with shp53 used from Addgene Plasmid #27078.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCXLE-dCas9VP192-T2A-EGFP was a gift from Timo Otonkoski (Addgene plasmid # 69536 ; http://n2t.net/addgene:69536 ; RRID:Addgene_69536)
  • For your References section:

    Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Balboa D, Weltner J, Eurola S, Trokovic R, Wartiovaara K, Otonkoski T. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. 10.1016/j.stemcr.2015.08.001 PubMed 26352799