-
PurposeEpisomal plasmid encoding dCas9VP192
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCXLE
- Total vector size (bp) 15848
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-dCas9VP192-EGFP
-
Insert Size (bp)6802
- Promoter CAG
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer pCAG-F GCAACGTGCTGGTTATTGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bydCas9 Mutated from pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A), Addgene Plasmid #42335; pCXLE backbone with shp53 used from Addgene Plasmid #27078.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCXLE-dCas9VP192-T2A-EGFP was a gift from Timo Otonkoski (Addgene plasmid # 69536 ; http://n2t.net/addgene:69536 ; RRID:Addgene_69536) -
For your References section:
Conditionally Stabilized dCas9 Activator for Controlling Gene Expression in Human Cell Reprogramming and Differentiation. Balboa D, Weltner J, Eurola S, Trokovic R, Wartiovaara K, Otonkoski T. Stem Cell Reports. 2015 Sep 8;5(3):448-59. doi: 10.1016/j.stemcr.2015.08.001. 10.1016/j.stemcr.2015.08.001 PubMed 26352799