- 
            PurposeFor in vitro transcription of alpha-bungarotoxin mRNA that can be injected into embryos.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 69542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepmtb
 - Backbone size w/o insert (bp) 6353
 - Total vector size (bp) 6641
 - 
              Vector typeTol2, beta-actin promoter, sp6,t7 for zebrafish
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)Top10
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert namealpha-bungarotoxin
 - 
                  Alt namebtx
 - 
                    SpeciesSynthetic
 - 
                  Insert Size (bp)288
 - 
                    GenBank IDKT279887
 - Promoter beta-actin, sp6, t7
 
Cloning Information
- Cloning method Gibson Cloning
 - 5′ sequencing primer ggtcacatgcttgctgaaacgcc
 - 3′ sequencing primer GGT TTG TCC AAA CTC ATC AAT GTA TC (Common Sequencing Primers)
 
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made bysynthesized by GeneArt/ life technologies
 - 
            Articles Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
For in vitro transcription, linearize with EcoRV, XmaI, SmaI, PmeI, or SphI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pmtb-t7-alpha-bungarotoxin was a gift from Sean Megason (Addgene plasmid # 69542 ; http://n2t.net/addgene:69542 ; RRID:Addgene_69542) - 
                
For your References section:
Improved Long-Term Imaging of Embryos with Genetically Encoded alpha-Bungarotoxin. Swinburne IA, Mosaliganti KR, Green AA, Megason SG. PLoS One. 2015 Aug 5;10(8):e0134005. doi: 10.1371/journal.pone.0134005. eCollection 2015. PONE-D-14-56074 [pii] PubMed 26244658