pBS-L1PA4CHmneo
(Plasmid
#69607)
-
PurposeExpresses a neomycin tagged codon optimized L1PA4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript
- Backbone size w/o insert (bp) 3530
- Total vector size (bp) 11338
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418) ; G418 detects retrotransposition not the plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsStandard E.coli strains can be used.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameL1PA4
-
Alt nameLINE-1 PA4 subfamily
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7800
- Promoter CMV
-
Tag
/ Fusion Protein
- mneo retrotransposition cassette
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGGCGTGTACGGTGGGAGGTCTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The ORF1 and ORF2 of the L1PA4 element were commercially synthetically generated and then cloned into the parental pBS-L1PA1CHmneo by swapping the two ORFs.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBS-L1PA4CHmneo was a gift from Astrid Roy-Engel (Addgene plasmid # 69607 ; http://n2t.net/addgene:69607 ; RRID:Addgene_69607) -
For your References section:
Molecular reconstruction of extinct LINE-1 elements and their interaction with nonautonomous elements. Wagstaff BJ, Kroutter EN, Derbes RS, Belancio VP, Roy-Engel AM. Mol Biol Evol. 2013 Jan;30(1):88-99. doi: 10.1093/molbev/mss202. Epub 2012 Aug 23. 10.1093/molbev/mss202 PubMed 22918960