Skip to main content

pAS1NB m Rosella I
(Plasmid #71247)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71247 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAS1NB
  • Total vector size (bp) 9209
  • Vector type
    Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Rosella
  • Alt name
    DsRed.T3
  • Alt name
    super ecliptic pHluorin (SEP)
  • Species
    Synthetic
  • Promoter PGK1
  • Tag / Fusion Protein
    • yeast mitochondrial targeting sequence of citrate synthase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer PPGK1-F (cagcctgttctcacacactc)
  • 3′ sequencing primer yPGK1-term-R (AGCGTAAAGGATGGGGAAAG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The primer pair CIT2Up (5'‑GAAGATCTAAACAATGTCAG TCGATATTATC) and CIT2Do (5'‑GAGGATCCGTAATTTCA GCAAATCTCTCC) was used to amplify the yeast mitochondrial targeting sequence of citrate synthase flanked by BglII sites from yeast genomic DNA. The resultant PCR fragment, following digestion with BglII, was ligated in‑frame at the 5' end of the Rosella expression cassette.

Note: This plasmid may run as a dimer. It may be helpful to follow protocols for low copy plasmids.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS1NB m Rosella I was a gift from Mark Prescott (Addgene plasmid # 71247 ; http://n2t.net/addgene:71247 ; RRID:Addgene_71247)
  • For your References section:

    Rosella: a fluorescent pH-biosensor for reporting vacuolar turnover of cytosol and organelles in yeast. Rosado CJ, Mijaljica D, Hatzinisiriou I, Prescott M, Devenish RJ. Autophagy. 2008 Feb;4(2):205-13. Epub 2007 Nov 21. 5331 [pii] PubMed 18094608