HSP70l-APEX2-GBP in pDEST-Tol2-pA2-acrys-mCherry
(Plasmid
#71282)
-
PurposeZebrafish expression vector for heat-shock inducible expression of APEX2-GBP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 71282 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDEST-Tol2-pA2 acrys-mCherry
-
Vector typeZebrafish expression with Tol2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPEX2-GBP
-
SpeciesSynthetic
- Promoter HSP70l
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CCCAACTGTGAGTGCTGATT
- 3′ sequencing primer TTGGTGAGCCTCAGCGTAAT (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HSP70l-APEX2-GBP in pDEST-Tol2-pA2-acrys-mCherry was a gift from Rob Parton (Addgene plasmid # 71282 ; http://n2t.net/addgene:71282 ; RRID:Addgene_71282) -
For your References section:
Modular Detection of GFP-Labeled Proteins for Rapid Screening by Electron Microscopy in Cells and Organisms. Ariotti N, Hall TE, Rae J, Ferguson C, McMahon KA, Martel N, Webb RE, Webb RI, Teasdale RD, Parton RG. Dev Cell. 2015 Nov 23;35(4):513-25. doi: 10.1016/j.devcel.2015.10.016. Epub 2015 Nov 12. 10.1016/j.devcel.2015.10.016 PubMed 26585296