-
PurposeExpression of mutated L. gasseri gusA from strong Ppgm promoter
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71803 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTRK882
-
Backbone manufacturerN/A
- Backbone size w/o insert (bp) 4568
- Total vector size (bp) 6470
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)E. coli MC1061
-
Growth instructionsCloning and propagation in E. coli MC1061. Erythromycin selection is 150 ug/ml
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegusA3
-
Alt namemutated gusA from L. gasseri ADH
-
SpeciesLactobacillus gasseri
-
Insert Size (bp)1902
-
MutationD573A
- Promoter Ppgm
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTTGAAGAAGCTAAGAAGGCT
- 3′ sequencing primer GTTATTATCAGTGTATAAGCT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRK892 was a gift from Rodolphe Barrangou & Todd Klaenhammer (Addgene plasmid # 71803 ; http://n2t.net/addgene:71803 ; RRID:Addgene_71803) -
For your References section:
Construction of vectors for inducible and constitutive gene expression in Lactobacillus. Duong T, Miller MJ, Barrangou R, Azcarate-Peril MA, Klaenhammer TR. Microb Biotechnol. 2011 May;4(3):357-67. doi: 10.1111/j.1751-7915.2010.00200.x. Epub 2010 Sep 1. 10.1111/j.1751-7915.2010.00200.x PubMed 21375708