-
Purposeexpression of improved FLP recombinase
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72871 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCASPER
- Backbone size w/o insert (bp) 10090
- Total vector size (bp) 11362
-
Modifications to backbonecontains ubi63E promoter and a SV40 polyA-signal
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFLP recombinase
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1272
-
MutationP2->S, added NLS
-
Entrez Geneflp
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHi (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer tcccatttttattccccagccag
- 3′ sequencing primer TGATCAGATAAGTTCAATGATATCCA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this vector is very similar to pMH5 (addgene 52531) but contains an activating point mutation (P2->S) and an additional N-terminal NLS
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKF295 was a gift from Klaus Foerstemann (Addgene plasmid # 72871 ; http://n2t.net/addgene:72871 ; RRID:Addgene_72871) -
For your References section:
A Comprehensive Toolbox for Genome Editing in Cultured Drosophila melanogaster Cells. Kunzelmann S, Bottcher R, Schmidts I, Forstemann K. G3 (Bethesda). 2016 Jun 1;6(6):1777-85. doi: 10.1534/g3.116.028241. 10.1534/g3.116.028241 PubMed 27172193