pRR-AR
(Plasmid
#73045)
-
PurposeConstitutively expresses the androgen receptor, which is required for the activation of the promoter in pLAREG (Addgene plasmid #73045)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73045 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRW95-3
-
Backbone manufacturerPMID: 8800671
- Total vector size (bp) 8889
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAndrogen receptor
-
SpeciesH. sapiens (human)
-
Mutationplease see depositor comments below
-
Entrez GeneAR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
- Promoter glyceraldehyde phosphate dehydrogenase (GPD)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GPDpro (CGGTAGGTATTGATTGTAATTCTG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are several discrepancies between Addgene's quality control sequences and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
This plasmid is a non-integrative plasmid that maintains approximately a single copy per cell and was used to express the glyceraldehyde phosphate dehydrogenase (GPD) driven androgen receptor gene. pRR-AR-5Z, a gift from Charles Miller (Addgene plasmid # 23058) was modified by excising the 5RE-cyc and lacZ portions using the BlpI and AatII restriction enzymes to create pRR-AR.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRR-AR was a gift from David McMillen (Addgene plasmid # 73045 ; http://n2t.net/addgene:73045 ; RRID:Addgene_73045) -
For your References section:
Design and characterization of a dual-mode promoter with activation and repression capability for tuning gene expression in yeast. Mazumder M, McMillen DR. Nucleic Acids Res. 2014 Aug;42(14):9514-22. doi: 10.1093/nar/gku651. Epub 2014 Jul 23. 10.1093/nar/gku651 PubMed 25056312