-
PurposeFull-length horseradish peroxidase (HRP) fused to the C-terminus of the yeast mating protein Aga2P. Galactose-inducible expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73152 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCTCON2
- Backbone size w/o insert (bp) 55791
- Total vector size (bp) 7171
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAga2P-HRP
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1380
- Promoter GAL1
-
Tags
/ Fusion Proteins
- HA tag
- myc tag
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gactacgctctgcaggagaacttg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HRP = full-length horseradish peroxidase.
This vector contains the following features:
EcoRI-Aga2P-HA-TEVs-15 aa linker-NheI-HRP-3 aa linker-BamHI-myc-stop-XhoI
GAL1 promoter (galactose inducible)
15 aa linker: GGGGSGGGGSGGGGS
3 aa linker: GSG
HA: YPYDVPDYA
myc: EQKLISEEDL
TEVs: ENLYFQG, cleavage recognition site for TEV protease
This construct is derived from the previously reported Aga2P-HRP construct (Lam et. al. Nature Methods, 12, 51-54, 2015), except the codon optimization of the synthetic HRP gene is different in this construct.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCTCON2 Aga2P-HRP was a gift from Alice Ting (Addgene plasmid # 73152 ; http://n2t.net/addgene:73152 ; RRID:Addgene_73152) -
For your References section:
A split horseradish peroxidase for the detection of intercellular protein-protein interactions and sensitive visualization of synapses. Martell JD, Yamagata M, Deerinck TJ, Phan S, Kwa CG, Ellisman MH, Sanes JR, Ting AY. Nat Biotechnol. 2016 May 30. doi: 10.1038/nbt.3563. 10.1038/nbt.3563 PubMed 27240195