-
PurposepMA7CR_2.0 contains arabinose inducible λ/RED β-protein and dam, and aTc inducible CRISPR/Cas9 and recX
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 73950 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD24
- Total vector size (bp) 10959
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namecas9
-
SpeciesBacteria
-
Insert Size (bp)4107
- Promoter pTet
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tttgttgcgcgctttatcgc
- 3′ sequencing primer gcgacacggaaatgttgaat
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namelambda beta
-
Insert Size (bp)786
- Promoter pAra
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tgccatagcatttttatccat
- 3′ sequencing primer taaggcggatcgcaatagac
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namedam
-
Insert Size (bp)837
- Promoter pAra
Cloning Information for Gene/Insert 3
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gtcgacccacaggaactgat
- 3′ sequencing primer ccgccaggcaaattctgt
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namerecX
-
Insert Size (bp)501
- Promoter pTet
Cloning Information for Gene/Insert 4
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tatctgttgtttgtcggtgaacg
- 3′ sequencing primer gcggtctgtatttcccagaa
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA7CR_2.0 was a gift from Alex Nielsen (Addgene plasmid # 73950 ; http://n2t.net/addgene:73950 ; RRID:Addgene_73950) -
For your References section:
CRMAGE: CRISPR Optimized MAGE Recombineering. Ronda C, Pedersen LE, Sommer MO, Nielsen AT. Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452. 10.1038/srep19452 PubMed 26797514