Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMA7CR_2.0
(Plasmid #73950)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73950 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD24
  • Total vector size (bp) 10959
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    cas9
  • Species
    Bacteria
  • Insert Size (bp)
    4107
  • Promoter pTet

Cloning Information for Gene/Insert 1

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tttgttgcgcgctttatcgc
  • 3′ sequencing primer gcgacacggaaatgttgaat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    lambda beta
  • Insert Size (bp)
    786
  • Promoter pAra

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tgccatagcatttttatccat
  • 3′ sequencing primer taaggcggatcgcaatagac
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    dam
  • Insert Size (bp)
    837
  • Promoter pAra

Cloning Information for Gene/Insert 3

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gtcgacccacaggaactgat
  • 3′ sequencing primer ccgccaggcaaattctgt
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    recX
  • Insert Size (bp)
    501
  • Promoter pTet

Cloning Information for Gene/Insert 4

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer tatctgttgtttgtcggtgaacg
  • 3′ sequencing primer gcggtctgtatttcccagaa
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMA7CR_2.0 was a gift from Alex Nielsen (Addgene plasmid # 73950 ; http://n2t.net/addgene:73950 ; RRID:Addgene_73950)
  • For your References section:

    CRMAGE: CRISPR Optimized MAGE Recombineering. Ronda C, Pedersen LE, Sommer MO, Nielsen AT. Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452. 10.1038/srep19452 PubMed 26797514