Skip to main content

pcDNA3-Myc-ASC
(Plasmid #73952)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73952 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5459
  • Total vector size (bp) 6100
  • Modifications to backbone
    A c-myc tag and a modified MCS were inserted as indicated in the attached plasmid map.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PYD and CARD domain containing, PYCARD
  • Alt name
    ASC
  • Alt name
    TMS-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    636
  • GenBank ID
    NM_013258.4
  • Entrez Gene
    PYCARD (a.k.a. ASC, CARD5, TMS, TMS-1, TMS1)
  • Promoter CMV
  • Tag / Fusion Protein
    • c-myc (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer T7 promoter (TAATACGACTCACTATAGGG)
  • 3′ sequencing primer SP6 promoter (ATTTAGGTGACACTATAG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-Myc-ASC was a gift from Christian Stehlik (Addgene plasmid # 73952 ; http://n2t.net/addgene:73952 ; RRID:Addgene_73952)
  • For your References section:

    Activation of inflammasomes requires intracellular redistribution of the apoptotic speck-like protein containing a caspase recruitment domain. Bryan NB, Dorfleutner A, Rojanasakul Y, Stehlik C. J Immunol. 2009 Mar 1;182(5):3173-82. doi: 10.4049/jimmunol.0802367. 10.4049/jimmunol.0802367 PubMed 19234215