-
Purposeself-killing gRNA plasmid pMAZ-SK
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 73962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCOLADuet
-
Backbone manufacturerMerck Millipore
- Total vector size (bp) 2779
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceaacgaaaccgtcgttgtagt
- Promoter pTet
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer tctggtcctcgagtctggtt
- 3′ sequencing primer aggataccggtaggctgcat (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAZ-SK was a gift from Alex Nielsen (Addgene plasmid # 73962 ; http://n2t.net/addgene:73962 ; RRID:Addgene_73962) -
For your References section:
CRMAGE: CRISPR Optimized MAGE Recombineering. Ronda C, Pedersen LE, Sommer MO, Nielsen AT. Sci Rep. 2016 Jan 22;6:19452. doi: 10.1038/srep19452. 10.1038/srep19452 PubMed 26797514