Skip to main content

CMV-FlicR1
(Plasmid #74142)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 74142 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5546
  • Total vector size (bp) 7043
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FlicR1
  • Alt name
    Fluorescent indicator for voltage imaging Red
  • Species
    Synthetic
  • Insert Size (bp)
    1497
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-FlicR1 was a gift from Robert Campbell (Addgene plasmid # 74142 ; http://n2t.net/addgene:74142 ; RRID:Addgene_74142)
  • For your References section:

    A Bright and Fast Red Fluorescent Protein Voltage Indicator That Reports Neuronal Activity in Organotypic Brain Slices. Abdelfattah AS, Farhi SL, Zhao Y, Brinks D, Zou P, Ruangkittisakul A, Platisa J, Pieribone VA, Ballanyi K, Cohen AE, Campbell RE. J Neurosci. 2016 Feb 24;36(8):2458-72. doi: 10.1523/JNEUROSCI.3484-15.2016. 10.1523/JNEUROSCI.3484-15.2016 PubMed 26911693