-
PurposeMammalian expression of FlicR1: A bright red fluorescent genetically encoded voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74142 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5546
- Total vector size (bp) 7043
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFlicR1
-
Alt nameFluorescent indicator for voltage imaging Red
-
SpeciesSynthetic
-
Insert Size (bp)1497
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-FlicR1 was a gift from Robert Campbell (Addgene plasmid # 74142 ; http://n2t.net/addgene:74142 ; RRID:Addgene_74142) -
For your References section:
A Bright and Fast Red Fluorescent Protein Voltage Indicator That Reports Neuronal Activity in Organotypic Brain Slices. Abdelfattah AS, Farhi SL, Zhao Y, Brinks D, Zou P, Ruangkittisakul A, Platisa J, Pieribone VA, Ballanyi K, Cohen AE, Campbell RE. J Neurosci. 2016 Feb 24;36(8):2458-72. doi: 10.1523/JNEUROSCI.3484-15.2016. 10.1523/JNEUROSCI.3484-15.2016 PubMed 26911693