pMSCV-puro-PAX9
(Plasmid
#75079)
-
Purposeretroviral vector holding human PAX9 cDNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMSCV-puro
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePAX9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1026
-
Mutationwild-type, full-length, without native 3' UTR
-
GenBank ID
-
Entrez GenePAX9 (a.k.a. STHAG3)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Xho I (not destroyed)
- 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
- 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCV-puro-PAX9 was a gift from David Mu (Addgene plasmid # 75079 ; http://n2t.net/addgene:75079 ; RRID:Addgene_75079) -
For your References section:
Oncogenic cooperation and coamplification of developmental transcription factor genes in lung cancer. Kendall J, Liu Q, Bakleh A, Krasnitz A, Nguyen KC, Lakshmi B, Gerald WL, Powers S, Mu D. Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16663-8. Epub 2007 Oct 9. 10.1073/pnas.0708286104 PubMed 17925434