Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

tetO-ALN
(Plasmid #43918)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 43918 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FU-tetO-Gateway
  • Backbone manufacturer
    Addgene plasmid 43914
  • Backbone size w/o insert (bp) 8600
  • Total vector size (bp) 12400
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Zeo marker is outside the LTRs and will not be packaged into virus.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recA cells, such as STBL3 (Invitrogen)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ASCL1-2A-LMX1B-2A-NURR1
  • Alt name
    ASCL1
  • Alt name
    LMX1B
  • Alt name
    NURR1 (NR4A2)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3800
  • Mutation
    Gylcine-serine-glycine (GSG) linker followed by viral 2A peptide sequence inserted between each ORF
  • GenBank ID
    DQ894571/EL736297/EU832740 (Genbank Accession Numbers) 100009031/13957/100067769 (Open Biosystems IDs)
  • Entrez Gene
    ASCL1 (a.k.a. ASH1, HASH1, MASH1, bHLHa46)
  • Entrez Gene
    LMX1B (a.k.a. LMX1.2, NPS1)
  • Entrez Gene
    NR4A2 (a.k.a. HZF-3, NOT, NURR1, RNR1, TINUR)
  • Promoter TRE promoter, Tet-ON
  • Tags / Fusion Proteins
    • V5 (C terminal on backbone)
    • 6xHis (C terminal on backbone)

Cloning Information

Resource Information

Depositor Comments

To make a drug-inducible lentiviral vector that is compatible with Gateway recombination (Invitrogen), the depositing laboratory removed the OCT4 open reading frame from FU-tetO-hOCT4 (Addgene plasmid 19778) and replaced it with a Gateway cassette cloned from pEF-DEST51 (Invitrogen) to generate FU-tetO-Gateway (Addgene plasmid #43914).

Open reading frames of human ASCL1, LMX1B, and NURR1 were purchased from Open Biosystems and amplified using the following PCR primers:

B1-ASCL1-FWD: GGGGacaagtttgtacaaaaaagcaggctACCATGGAAAG​CTCTGCCAAG;
ASCL1-REV: CATCTCCTGCTTGCTTTAACAGAGAGAAGTTCGTGGCACC​GGATCCGAACCAGTTGGTGAAGTC;
LMX1B-FWD: CTCTCTGTTAAAGCAAGCAGGAGATGTTGAAGAAAACCCC​GGGCCTATGTTGGACGGCATCAAG;
LMX1B-REV: ACGTCACCGCATGTTAGAAGACTTCCTCTGCCCTCTCCGG​ATCCGGAGGCGAAGTAGGAACT;
NURR1-FWD: GAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGG​CCCTATGCCTTGTGTTCAGGCG;
B2-NURR1-REV: GGGGaccactttgtacaagaaagctgggt[A]GAAAGGTAAAGTGTCCAG
(extra [A] added to maintain reading frame with C-terminal V5-tag).

The 3 ORFs were then joined via recombinant PCR such that viral 2A peptide sequences separate the three genes, using B1-ASCL1-FWD and B2-NURR1-REV. A glycine-serine-glycine (GSG) linker was included upstream of each 2A sequence to facilitate protein cleavage.

The ASCL1-P2A-LMX1B-T2A-NURR1(ALN) cassette was cloned into pDONR221, and subsequently cloned into FU-tetO-Gateway via Gateway recombination to produce the tetO-ALN vector.

Cleavage at 2A sites was verified by performing in vitro transcription and translation using the TnT T7 Coupled Reticulocyte Lysate System (Promega L4610) in the presence of biotinylated lysine (Promega L5061). 5 µL of each TnT-generated protein sample was resolved via PAGE, transferred to PVDF membrane, incubated with streptavidin-conjugated horseradish peroxidase (Cell Signaling Technology 3999, 1:2000), and detected with ECL Plus (GE Healthcare RPN2132).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    tetO-ALN was a gift from John Gearhart (Addgene plasmid # 43918 ; http://n2t.net/addgene:43918 ; RRID:Addgene_43918)
  • For your References section:

    Efficient conversion of astrocytes to functional midbrain dopaminergic neurons using a single polycistronic vector. Addis RC, Hsu FC, Wright RL, Dichter MA, Coulter DA, Gearhart JD. PLoS One. 2011;6(12):e28719. doi: 10.1371/journal.pone.0028719. Epub 2011 Dec 9. 10.1371/journal.pone.0028719 PubMed 22174877