pEGB2Ω2_SF-35s:hCas9:tNos (GB1103)
              
              
                (Plasmid
                
                #75400)
              
            
            
            
          - 
            PurposeTranscriptional unit for (human codon optimized) Cas9 plant expression driven by the 35S promoter. Specially conceived to be linked with the TU of the kanamycin resistance gene GB1181.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 75400 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepDGB2omega2
 - 
              Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
 - Backbone size w/o insert (bp) 6676
 - Total vector size (bp) 12511
 - 
              Vector typePlant Expression, CRISPR, Synthetic Biology
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Spectinomycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Gene/Insert
- 
                Gene/Insert namehCas9
 - 
                    SpeciesStreptococcus pyogenes
 - 
                  Insert Size (bp)5835
 - Promoter 35S
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site BsmBI (destroyed during cloning)
 - 3′ cloning site BsmBI (destroyed during cloning)
 - 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pEGB2Ω2_SF-35s:hCas9:tNos (GB1103) was a gift from Diego Orzaez (Addgene plasmid # 75400 ; http://n2t.net/addgene:75400 ; RRID:Addgene_75400) - 
                
For your References section:
A modular toolbox for gRNA-Cas9 genome engineering in plants based on the GoldenBraid standard. Vazquez-Vilar M, Bernabe-Orts JM, Fernandez-Del-Carmen A, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Methods. 2016 Feb 1;12:10. doi: 10.1186/s13007-016-0101-2. eCollection 2016. 101 [pii] PubMed 26839579