Skip to main content
Addgene

pEx1-pEF-H2B-mCherry-T2A-rTetR-KRAB
(Plasmid #78348)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78348 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pExchange1
  • Backbone manufacturer
    Agilent Technologies
  • Backbone size w/o insert (bp) 4113
  • Total vector size (bp) 6102
  • Modifications to backbone
    original CMV was replaced with pEF cut with BamHI and KpnI before Gibson
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B-mCherry-T2A-rTetR-KRAB
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1989
  • GenBank ID
  • Promoter pEF alpha
  • Tag / Fusion Protein
    • rTetR (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer F1-factor: CTAAAGTGCGAAAGCGGCGG
  • 3′ sequencing primer T7 primer: TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    KRAB was PCR-amplified from PSV40-E-KRAB-pA (pWW43), a plasmid gifted by Martin Fussenegger; rTetR was PCR-amplified from the rtTA3 system, Clontech

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEx1-pEF-H2B-mCherry-T2A-rTetR-KRAB was a gift from Michael Elowitz (Addgene plasmid # 78348 ; http://n2t.net/addgene:78348 ; RRID:Addgene_78348)
  • For your References section:

    Dynamics of epigenetic regulation at the single-cell level. Bintu L, Yong J, Antebi YE, McCue K, Kazuki Y, Uno N, Oshimura M, Elowitz MB. Science. 2016 Feb 12;351(6274):720-4. doi: 10.1126/science.aab2956. 10.1126/science.aab2956 PubMed 26912859