-
PurposeExpresses camelid anti-GFP nanobody fused to TRPV1 and GFP-ferritin chimera fusion protein
-
Depositing Lab
-
Sequence Information
-
Sequences (4) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepVQAd-AscI-CMV-NPa
-
Backbone manufacturerViraquest
- Backbone size w/o insert (bp) 6217
- Total vector size (bp) 11351
-
Modifications to backbonenone
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nametransient receptor potential vanillin 1
-
Alt nameTRPV1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)2512
-
Entrez GeneTrpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site avrII (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer ggtctatataagcagagctg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecamelid anti-GFP nanobody
-
Speciescamelid
-
Insert Size (bp)351
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctagtgccaccATGGCCGATGTGCAG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameEnhanced green fluorescent protein
-
Alt nameEGFP
-
Insert Size (bp)717
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer gagcttctccctgaggtca (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namemouse ferritin light chain
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)549
-
Entrez GeneFtl1 (a.k.a. Ftl, Ftl-1, L-ferritin)
- Promoter CMV
Cloning Information for Gene/Insert 4
- Cloning method Unknown
- 5′ sequencing primer CATGGTCCTGCTGGAGTTCGTG (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namemouse ferritin heavy chain
-
SpeciesM. musculus (mouse)
-
Entrez GeneFth1 (a.k.a. FHC, Fth, HFt, MFH)
- Promoter CMV
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer GACTACAAGGACGACGACGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWolfgang Liedtke
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVQ CMV NanoV1-2a-EGFP ferritin was a gift from Jeffrey Friedman (Addgene plasmid # 79649 ; http://n2t.net/addgene:79649 ; RRID:Addgene_79649) -
For your References section:
Bidirectional electromagnetic control of the hypothalamus regulates feeding and metabolism. Stanley SA, Kelly L, Latcha KN, Schmidt SF, Yu X, Nectow AR, Sauer J, Dyke JP, Dordick JS, Friedman JM. Nature. 2016 Mar 31;531(7596):647-50. doi: 10.1038/nature17183. Epub 2016 Mar 23. 10.1038/nature17183 PubMed 27007848