Skip to main content
Addgene

pVQ CMV NanoV1-2a-EGFP ferritin
(Plasmid #79649)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79649 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pVQAd-AscI-CMV-NPa
  • Backbone manufacturer
    Viraquest
  • Backbone size w/o insert (bp) 6217
  • Total vector size (bp) 11351
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    transient receptor potential vanillin 1
  • Alt name
    TRPV1
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    2512
  • Entrez Gene
    Trpv1 (a.k.a. TRPV1_SON, VR.5'sv, Vr1, Vr1l1)
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site avrII (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer ggtctatataagcagagctg
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    camelid anti-GFP nanobody
  • Species
    camelid
  • Insert Size (bp)
    351
  • Promoter CMV

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Enhanced green fluorescent protein
  • Alt name
    EGFP
  • Insert Size (bp)
    717
  • Promoter CMV

Cloning Information for Gene/Insert 3

Gene/Insert 4

  • Gene/Insert name
    mouse ferritin light chain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    549
  • Entrez Gene
    Ftl1 (a.k.a. Ftl, Ftl-1, L-ferritin)
  • Promoter CMV

Cloning Information for Gene/Insert 4

Gene/Insert 5

  • Gene/Insert name
    mouse ferritin heavy chain
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Fth1 (a.k.a. FHC, Fth, HFt, MFH)
  • Promoter CMV

Cloning Information for Gene/Insert 5

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Wolfgang Liedtke
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pVQ CMV NanoV1-2a-EGFP ferritin was a gift from Jeffrey Friedman (Addgene plasmid # 79649 ; http://n2t.net/addgene:79649 ; RRID:Addgene_79649)
  • For your References section:

    Bidirectional electromagnetic control of the hypothalamus regulates feeding and metabolism. Stanley SA, Kelly L, Latcha KN, Schmidt SF, Yu X, Nectow AR, Sauer J, Dyke JP, Dordick JS, Friedman JM. Nature. 2016 Mar 31;531(7596):647-50. doi: 10.1038/nature17183. Epub 2016 Mar 23. 10.1038/nature17183 PubMed 27007848