- 
            PurposeExpress TagRFP labeled human Rab5a (GTPase located on early endosomal membranes).
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79802 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
- 
            Vector backbonepTagRFP-C vector
 - 
              Backbone manufacturerEvrogen
 - 
              Vector typeMammalian Expression
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberUnknown
 
Gene/Insert
- 
                Gene/Insert nameRab5a
 - 
                    SpeciesH. sapiens (human)
 - 
                        Entrez GeneRAB5A (a.k.a. RAB5)
 - Promoter CMV
 - 
    
        Tags
        / Fusion Proteins
    
- TagRFP (N terminal on backbone)
 - myc (C terminal on insert)
 
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ cloning site unknown (unknown if destroyed)
 - 3′ cloning site unknown (unknown if destroyed)
 - 5′ sequencing primer TagRFPmKate-F1 (AGGCCGACAAAGAGACCTAC)
 - 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pTag-RFP-C-h-Rab5a-c-Myc was a gift from James Johnson (Addgene plasmid # 79802 ; http://n2t.net/addgene:79802 ; RRID:Addgene_79802) - 
                
For your References section:
Inter-domain tagging implicates caveolin-1 in insulin receptor trafficking and Erk signaling bias in pancreatic beta-cells. Boothe T, Lim GE, Cen H, Skovso S, Piske M, Li SN, Nabi IR, Gilon P, Johnson JD. Mol Metab. 2016 Feb 10;5(5):366-78. doi: 10.1016/j.molmet.2016.01.009. eCollection 2016 May. S2212-8778(16)00021-1 [pii] PubMed 27110488