-
PurposeExpresses PpsR2-mVenus-CAAX under CMVd1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFC15K
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2800
- Total vector size (bp) 5000
-
Vector typeMammalian Expression
-
Selectable markersNone
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePpsR2-mVenus-CAAX
-
SpeciesRhodopseudomonas palustris
-
Insert Size (bp)2200
-
MutationRpPpsR2 cysteine 439 changed to serine
-
GenBank IDKX063612 CAE26978.1
- Promoter CMVd1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsisI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtgggag
- 3′ sequencing primer GCA TCA CAA ATT TCA CAA ATA AAG C (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byA RpPpsR2 gene of R. palustris (NCBI Gene rpa1536) (accession code CAE26978) was provided by M. Papiz (Liverpool University, UK) and T. Beatty (University of British Columbia, Canada).
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKA-142 was a gift from Vladislav Verkhusha (Addgene plasmid # 79835 ; http://n2t.net/addgene:79835 ; RRID:Addgene_79835) -
For your References section:
A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085