Skip to main content

pKA-144
(Plasmid #79839)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79839 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFC15K
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 2700
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    RpBphP1-mCherry-Intersectin1 DHPH domain
  • Species
    Rhodopseudomonas palustris
  • Insert Size (bp)
    4100
  • GenBank ID
    NCBI Gene rpa1537 KX063613
  • Promoter CMVd1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtgggag
  • 3′ sequencing primer GCA TCA CAA ATT TCA CAA ATA AAG C
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    RpBphP1 gene of R. palustris (NCBI Gene rpa1537) was provided by E. Giraud (Institute for Research and Development, France) A DHPH domain of human intersectin-1 was PCR amplified from a plasmid (Addgene #22278)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKA-144 was a gift from Vladislav Verkhusha (Addgene plasmid # 79839 ; http://n2t.net/addgene:79839 ; RRID:Addgene_79839)
  • For your References section:

    A bacterial phytochrome-based optogenetic system controllable with near-infrared light. Kaberniuk AA, Shemetov AA, Verkhusha VV. Nat Methods. 2016 May 9. doi: 10.1038/nmeth.3864. 10.1038/nmeth.3864 PubMed 27159085