Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

R10-3 /pQE-30
(Plasmid #79859)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79859 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pQE-30
  • Backbone manufacturer
    QIAGEN
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 4250
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    R10-3
  • Alt name
    R103
  • Species
    Synthetic
  • Insert Size (bp)
    750
  • Mutation
    Aequorea victoria green fluorescent protein (avGFP) with substitutions F46L, F64L, V68N, V163A, K162Q, I167V, and I171L.
  • GenBank ID
    KX377674 KX377674
  • Promoter T5 promoter / lac operator
  • Tag / Fusion Protein
    • HisTag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
  • 3′ sequencing primer CCGAGCGTTCTGAACAAATC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    R10-3 /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 79859 ; http://n2t.net/addgene:79859 ; RRID:Addgene_79859)
  • For your References section:

    The first mutant of the Aequorea victoria green fluorescent protein that forms a red chromophore. Mishin AS, Subach FV, Yampolsky IV, King W, Lukyanov KA, Verkhusha VV. Biochemistry. 2008 Apr 22;47(16):4666-73. doi: 10.1021/bi702130s. Epub 2008 Mar 27. 10.1021/bi702130s PubMed 18366185