Skip to main content
Addgene

pJMP2
(Plasmid #79874)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79874 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDG1662
  • Backbone size w/o insert (bp) 6982
  • Total vector size (bp) 7572
  • Modifications to backbone
    The rfp-targeting sgRNA RR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251) using primers containing the veg promoter and EcoRI sites, digested with EcoRI, then ligated into either pDG1662 digested with EcoRI to generate pJMP2.
  • Vector type
    Bacterial Expression, CRISPR
  • Selectable markers
    Bacillus subtilis chloramphenicol marker

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA RR1
  • Alt name
    sgRNA NT
  • Alt name
    anti-RFP sgRNA
  • gRNA/shRNA sequence
    AACTTTCAGTTTAGCGGTCT
  • Species
    Streptococcus pyogenes
  • Promoter veg

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agtgattatgccgcgatttc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The rfp-targeting sgRNA RR1 was PCR-amplified from pgRNA-bacteria (Addgene #44251)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMP2 was a gift from Carol Gross & Jason Peters & Stanley Qi (Addgene plasmid # 79874 ; http://n2t.net/addgene:79874 ; RRID:Addgene_79874)
  • For your References section:

    A Comprehensive, CRISPR-based Functional Analysis of Essential Genes in Bacteria. Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS, Brown ED, Qi LS, Huang KC, Gross CA. Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003. Epub 2016 May 26. 10.1016/j.cell.2016.05.003 PubMed 27238023