-
PurposeAAVS1 TALEN expression vector (Left)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80495 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDONR221
- Backbone size w/o insert (bp) 2300
- Total vector size (bp) 5863
-
Modifications to backbonesilent mutation to remove Esp3I site in KanR
-
Vector typeGateway Entry
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAVS1 TALEN (Left)
-
SpeciesSynthetic
-
Insert Size (bp)3573
- Promoter none
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTACAAACTCTTCCTGTTAGTTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Gateway assembled into a custom Gateway Entry vector using Addgene Kit #1000000024
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTALdNC-AAVS1_T1 was a gift from Knut Woltjen (Addgene plasmid # 80495 ; http://n2t.net/addgene:80495 ; RRID:Addgene_80495) -
For your References section:
Engineering the AAVS1 locus for consistent and scalable transgene expression in human iPSCs and their differentiated derivatives. Oceguera-Yanez F, Kim SI, Matsumoto T, Tan GW, Xiang L, Hatani T, Kondo T, Ikeya M, Yoshida Y, Inoue H, Woltjen K. Methods. 2015 Dec 18. pii: S1046-2023(15)30181-X. doi: 10.1016/j.ymeth.2015.12.012. 10.1016/j.ymeth.2015.12.012 PubMed 26707206