-
PurposeMammalian expression vector that expresses a VSV-G protein with a FLAG tag near the N-terminus of the protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerLife Technologies
- Backbone size w/o insert (bp) 5349
- Total vector size (bp) 6939
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSV-G
-
Alt nameVesicular Stomatitis Virus Glycoprotein
-
SpeciesVesicular Stomatitis Virus
-
Insert Size (bp)1590
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAACCCACTGCTTACTGGC
- 3′ sequencing primer GTCGAGGCTGATCAGCGAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-FLAG-VSVG was a gift from Sven Eyckerman (Addgene plasmid # 80606 ; http://n2t.net/addgene:80606 ; RRID:Addgene_80606) -
For your References section:
Trapping mammalian protein complexes in viral particles. Eyckerman S, Titeca K, Van Quickelberghe E, Cloots E, Verhee A, Samyn N, De Ceuninck L, Timmerman E, De Sutter D, Lievens S, Van Calenbergh S, Gevaert K, Tavernier J. Nat Commun. 2016 Apr 28;7:11416. doi: 10.1038/ncomms11416. 10.1038/ncomms11416 PubMed 27122307