Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
As of April 1, 2023, we increased some of our prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMT-HuC:Dendra2
(Plasmid #80904)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80904 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMTB
  • Backbone size w/o insert (bp) 6897
  • Total vector size (bp) 7614
  • Vector type
    Zebrafish Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Dendra2
  • Species
    Synthetic
  • Insert Size (bp)
    717
  • GenBank ID
    AF_173984
  • Entrez Gene
    elavl3 (a.k.a. HuC, elrc, id:ibd1248, wu:fb77b03, zHuC)
  • Promoter HuC

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer atctttgtacgtcaagacctagg
  • 3′ sequencing primer taatacgactcactatagggag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT-HuC:Dendra2 was a gift from Periklis Pantazis (Addgene plasmid # 80904 ; http://n2t.net/addgene:80904 ; RRID:Addgene_80904)
  • For your References section:

    Labeling cellular structures in vivo using confined primed conversion of photoconvertible fluorescent proteins. Mohr MA, Argast P, Pantazis P. Nat Protoc. 2016 Dec;11(12):2419-2431. doi: 10.1038/nprot.2016.134. Epub 2016 Nov 3. 10.1038/nprot.2016.134 PubMed 27809312