-
PurposeDrosophila gRNA expression plasmid targets ebony
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83380 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCFD3
-
Backbone manufacturerBullock and Port
- Backbone size w/o insert (bp) 6229
- Total vector size (bp) 6249
-
Modifications to backboneInsertion of ebony target sequence into Bbs1 site of pCFD3
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameebony
-
Alt namegRNA-ebony
-
gRNA/shRNA sequenceGCCACAATTGTCGATCGTCA
-
SpeciesD. melanogaster (fly)
-
Entrez Genee (a.k.a. Dmel_CG3331, CG3331, Dmel\CG3331, Ebony)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T3
- 3′ sequencing primer M13Rev (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe pCFD3 vector and ebony gRNA sequence are from Bullock and Port.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCFD3-ebony was a gift from Richard Padgett (Addgene plasmid # 83380 ; http://n2t.net/addgene:83380 ; RRID:Addgene_83380) -
For your References section:
Efficient Screening of CRISPR/Cas9-Induced Events in Drosophila Using a Co-CRISPR Strategy. Kane NS, Vora M, Varre KJ, Padgett RW. G3 (Bethesda). 2017 Jan 5;7(1):87-93. doi: 10.1534/g3.116.036723. 10.1534/g3.116.036723 PubMed 27793971