-
PurposeLentiviral Sp dCas9-p300-P2A-PuroR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 83889 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
- Backbone size w/o insert (bp) 7800
- Total vector size (bp) 14538
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300)
-
SpeciesH. sapiens (human), Synthetic; S. pyogenes
-
Insert Size (bp)6138
-
MutationD10A; H840A in S.pyogenes Cas9
-
GenBank IDWP_010922251.1 NP_001420.2
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter EFS
-
Tags
/ Fusion Proteins
- nucleoplasmin NLS (C terminal on insert)
- Flag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCGGTGCCTAGAGAAGGT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepac from Streptomyces alboniger
-
Alt namepuromycin N-acetyltransferase
-
SpeciesStreptomyces alboniger
-
Insert Size (bp)597
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-dCas9-p300-P2A-PuroR was a gift from Charles Gersbach (Addgene plasmid # 83889 ; http://n2t.net/addgene:83889 ; RRID:Addgene_83889) -
For your References section:
CRISPR-Cas9 epigenome editing enables high-throughput screening for functional regulatory elements in the human genome. Klann TS, Black JB, Chellappan M, Safi A, Song L, Hilton IB, Crawford GE, Reddy TE, Gersbach CA. Nat Biotechnol. 2017 Apr 3. doi: 10.1038/nbt.3853. 10.1038/nbt.3853 PubMed 28369033