Skip to main content

pCRISPRia-v2
(Plasmid #84832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 84832 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSICO derivative
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 8888
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    sgRNA
  • Insert Size (bp)
    113
  • Promoter mU6

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstX1 (not destroyed)
  • 3′ cloning site Blp1 (not destroyed)
  • 5′ sequencing primer gcgccaattctgcagacaaa
  • 3′ sequencing primer CCTTCTCTAGGCACCGGTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    puro-T2A-BFP
  • Insert Size (bp)
    1371

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPRia-v2 was a gift from Jonathan Weissman (Addgene plasmid # 84832 ; http://n2t.net/addgene:84832 ; RRID:Addgene_84832)
  • For your References section:

    Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, Weissman JS. Elife. 2016 Sep 23;5. pii: e19760. doi: 10.7554/eLife.19760. 10.7554/eLife.19760 PubMed 27661255