-
PurposeCRISPRi/a V2 library parental plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 84832 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSICO derivative
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 8888
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesgRNA
-
Insert Size (bp)113
- Promoter mU6
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BstX1 (not destroyed)
- 3′ cloning site Blp1 (not destroyed)
- 5′ sequencing primer gcgccaattctgcagacaaa
- 3′ sequencing primer CCTTCTCTAGGCACCGGTTC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepuro-T2A-BFP
-
Insert Size (bp)1371
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRia-v2 was a gift from Jonathan Weissman (Addgene plasmid # 84832 ; http://n2t.net/addgene:84832 ; RRID:Addgene_84832) -
For your References section:
Compact and highly active next-generation libraries for CRISPR-mediated gene repression and activation. Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y, Fields AP, Park CY, Corn JE, Kampmann M, Weissman JS. Elife. 2016 Sep 23;5. pii: e19760. doi: 10.7554/eLife.19760. 10.7554/eLife.19760 PubMed 27661255