-
PurposeGreen/red FRET biosensor to monitor RhoA nucleotide loading state and activity
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85071 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTriEx
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5043
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRhoA Biosensor wildtype with mScarlet-i and SGFP2
-
Alt nameRHOA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2436
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
- Promoter CMV
-
Tags
/ Fusion Proteins
- 6xHis (C terminal on backbone)
- mScarlet-i and SGFP2 (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TGTGAGCCAGGGCATTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-RhoA-wt_mScarlet-i_SGFP2 was a gift from Dorus Gadella (Addgene plasmid # 85071 ; http://n2t.net/addgene:85071 ; RRID:Addgene_85071) -
For your References section:
mScarlet: a bright monomeric red fluorescent protein for cellular imaging. Bindels DS, Haarbosch L, van Weeren L, Postma M, Wiese KE, Mastop M, Aumonier S, Gotthard G, Royant A, Hink MA, Gadella TW Jr. Nat Methods. 2016 Nov 21. doi: 10.1038/nmeth.4074. 10.1038/nmeth.4074 PubMed 27869816