-
Purposelentiviral expression of myosin light chain (MLC, MYL9), N-terminally tagged with mTurquoise
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85145 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLV-EF1a-IRES-Neo
- Backbone size w/o insert (bp) 8980
- Total vector size (bp) 10208
-
Vector typeLentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTurquoise-MLC (myosin regulatory light chain, N-terminally tagged with mTurquoise
-
Alt nameMYL9
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1245
-
GenBank IDNM_006097.3
-
Entrez GeneMYL9 (a.k.a. LC20, MLC-2C, MLC2, MMIHS4, MRLC1, MYRL2)
- Promoter EF1a
-
Tag
/ Fusion Protein
- mTurquoise (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer ACACCGGCCTTATTCCAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byACCATGGGTTGAACC
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To reduce EF1a-driven expression, a uORF (ACCATGGGTTGAACC) has been inserted between EF1a and mTurquoise.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-mTurquoise-MLC-IRES-neo was a gift from Tobias Meyer (Addgene plasmid # 85145 ; http://n2t.net/addgene:85145 ; RRID:Addgene_85145) -
For your References section:
Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T. Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. 10.1038/ncb3438 PubMed 27842057