Skip to main content

pDule-tfmF A65V S158A
(Plasmid #85484)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85484 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pDule
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 6300
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Tetracycline, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tri-fluoromethyl-phenylalanine Mj synthetase A65V S158A
  • Alt name
    tfmF A65V S158A
  • Species
    Methanocaldococcus jannaschii
  • Insert Size (bp)
    921
  • Mutation
    Y32V F108W Q109M I159M with 65Val and 158Ala
  • Promoter lpp (constitutive)
  • Tag / Fusion Protein
    • None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer CGTCACTGCGTCTTTTACTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDule-tfmF A65V S158A was a gift from Ryan Mehl (Addgene plasmid # 85484 ; http://n2t.net/addgene:85484 ; RRID:Addgene_85484)
  • For your References section:

    Generating permissive site-specific unnatural aminoacyl-tRNA synthetases. Miyake-Stoner SJ, Refakis CA, Hammill JT, Lusic H, Hazen JL, Deiters A, Mehl RA. Biochemistry. 2010 Mar 2;49(8):1667-77. doi: 10.1021/bi901947r. 10.1021/bi901947r PubMed 20082521