-
PurposeMachinery plasmid expressing permissive Mj tfmF synthetase and cognate amber suppressing tRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85484 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDule
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 6300
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametri-fluoromethyl-phenylalanine Mj synthetase A65V S158A
-
Alt nametfmF A65V S158A
-
SpeciesMethanocaldococcus jannaschii
-
Insert Size (bp)921
-
MutationY32V F108W Q109M I159M with 65Val and 158Ala
- Promoter lpp (constitutive)
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGTCACTGCGTCTTTTACTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDule-tfmF A65V S158A was a gift from Ryan Mehl (Addgene plasmid # 85484 ; http://n2t.net/addgene:85484 ; RRID:Addgene_85484) -
For your References section:
Generating permissive site-specific unnatural aminoacyl-tRNA synthetases. Miyake-Stoner SJ, Refakis CA, Hammill JT, Lusic H, Hazen JL, Deiters A, Mehl RA. Biochemistry. 2010 Mar 2;49(8):1667-77. doi: 10.1021/bi901947r. 10.1021/bi901947r PubMed 20082521