-
PurposeConstitutive transcription of FnCpf1 and crRNA of crtYf
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85542 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXMJ19
- Backbone size w/o insert (bp) 5600
-
Vector typeBacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCpf1
-
SpeciesFrancisella tularensis subsp. novicida
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer M13pUC-Rev (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecrRNA of crtYf
-
Alt namecrRNA: gaatttctactgttgtagatcaggcaaccatagggcaggaa
-
SpeciesSynthetic
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer unknown
- 3′ sequencing primer pBAD-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYS3_ΔcrtYf was a gift from Sheng Yang (Addgene plasmid # 85542 ; http://n2t.net/addgene:85542 ; RRID:Addgene_85542) -
For your References section:
CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Jiang Y, Qian F, Yang J, Liu Y, Dong F, Xu C, Sun B, Chen B, Xu X, Li Y, Wang R, Yang S. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. 10.1038/ncomms15179 PubMed 28469274