Skip to main content

pJYS3_ΔcrtYf
(Plasmid #85542)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85542 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pXMJ19
  • Backbone size w/o insert (bp) 5600
  • Vector type
    Bacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cpf1
  • Species
    Francisella tularensis subsp. novicida

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    crRNA of crtYf
  • Alt name
    crRNA: gaatttctactgttgtagatcaggcaaccatagggcaggaa
  • Species
    Synthetic

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJYS3_ΔcrtYf was a gift from Sheng Yang (Addgene plasmid # 85542 ; http://n2t.net/addgene:85542 ; RRID:Addgene_85542)
  • For your References section:

    CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Jiang Y, Qian F, Yang J, Liu Y, Dong F, Xu C, Sun B, Chen B, Xu X, Li Y, Wang R, Yang S. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. 10.1038/ncomms15179 PubMed 28469274