-
PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistance
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepXMJ19 and pTRCmob
-
Vector typeBacterial Expression, CRISPR ; Shuttle vector Corynebacterium glutamicum / E. coli
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecrRNA of crtYf
-
gRNA/shRNA sequencecrRNA: gaatttctactgttgtagatcaggcaaccatagggcaggaa
-
SpeciesSynthetic
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYS2cm_crtYf was a gift from Sheng Yang (Addgene plasmid # 85543 ; http://n2t.net/addgene:85543 ; RRID:Addgene_85543) -
For your References section:
CRISPR-Cpf1 assisted genome editing of Corynebacterium glutamicum. Jiang Y, Qian F, Yang J, Liu Y, Dong F, Xu C, Sun B, Chen B, Xu X, Li Y, Wang R, Yang S. Nat Commun. 2017 May 4;8:15179. doi: 10.1038/ncomms15179. 10.1038/ncomms15179 PubMed 28469274