-
PurposeIntegrate plasmid of Streptococcus pneumoniae, which can integrate sgRNA targeting luc gene, which encode luciferase, into the locus between amiF and treR. This vector can be used as the template for
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPEP1
- Backbone size w/o insert (bp) 3245
- Total vector size (bp) 3415
-
Modifications to backboneChloramphenicol resistance marker was removed; gBlock of sgRNA targeting firefly luciferase encoding gene luc was inserted by BglII and BamHI digestion and ligation
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSpectinomycin 100 μg/ml
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting firefly luciferase encoding gene
-
Alt namesgRNAluc
-
SpeciesSynthetic
-
Insert Size (bp)140
- Promoter P3
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer TCTAGACGGTGATCAACACGCTAG
- 3′ sequencing primer CGAGGGATTTGGTGATTCTTCTT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For information of vector pPEP1 and promoter of P3, please refer to
"Sorg RA, Kuipers OP, Veening JW (2014) Gene Expression Platform for Synthetic Biology in the Human Pathogen Streptococcus pneumoniae. ACS synthetic biology"
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPEPX-P3-sgRNAluc was a gift from Jan-Willem Veening (Addgene plasmid # 85590 ; http://n2t.net/addgene:85590 ; RRID:Addgene_85590) -
For your References section:
High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437