Skip to main content
Addgene

pAW014-2
(Plasmid #85612)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85612 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    modified pIEFBPR (ColE1)
  • Backbone size w/o insert (bp) 8069
  • Total vector size (bp) 8172
  • Modifications to backbone
    Please see corresponding manuscript for plasmid construction details.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    HI-Control 10G
  • Growth instructions
    Use 90 ug/mL Sp for both organisms
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ugtP-gRNA.P395T
  • gRNA/shRNA sequence
    aaggaaaaactgctggagat

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW014-2 was a gift from Perry Chou (Addgene plasmid # 85612 ; http://n2t.net/addgene:85612 ; RRID:Addgene_85612)
  • For your References section:

    Development of a CRISPR-Cas9 toolkit for comprehensive engineering of Bacillus subtilis. Westbrook AW, Moo-Young M, Chou CP. Appl Environ Microbiol. 2016 Jun 3. pii: AEM.01159-16. 10.1128/AEM.01159-16 PubMed 27260361