Skip to main content

sgOpti
(Plasmid #85681)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85681 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-sgRNA
  • Backbone manufacturer
    Eric Lander and David Sabatini (Addgene #71409)
  • Backbone size (bp) 7000
  • Modifications to backbone
    Replaced sgRNA scaffold with sgRNA-(F+E)-combined optimized scaffold from Chen et al 2013 Cell.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter hU6
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer LKO.1 5' GACTATCATATGCTTACCGT
  • 3′ sequencing primer WPRE-R CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    sgOpti was a gift from Eric Lander & David Sabatini (Addgene plasmid # 85681 ; http://n2t.net/addgene:85681 ; RRID:Addgene_85681)
  • For your References section:

    Systematic mapping of functional enhancer-promoter connections with CRISPR interference. Fulco CP, Munschauer M, Anyoha R, Munson G, Grossman SR, Perez EM, Kane M, Cleary B, Lander ES, Engreitz JM. Science. 2016 Sep 29. pii: aag2445. 10.1126/science.aag2445 PubMed 27708057