Skip to main content

CMV epArcLight
(Plasmid #85803)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85803 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+ CMV
  • Backbone size w/o insert (bp) 5694
  • Total vector size (bp) 7167
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    epArcLight
  • Alt name
    CiVSD-ecliptic pHluorin
  • Alt name
    CiSP
  • Alt name
    ecliptic pHluorin
  • Species
    Ciona intestinalis
  • Mutation
    Ci-VSP contains R217Q mutation; ecliptic pHluorin contains A227D mutation. The A227D mutation increases the fluorescence response magnitude.
  • GenBank ID
    AB183035 AF058695.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer SP6
  • 3′ sequencing primer tgcgtgtggttcgattagcaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

A portion of this plasmid was derived from a plasmid made by Dr. Atsushi Miyawaki, Laboratory for Cell Function Dynamics, Brain Science Institute, RIKEN, 2-1 Hirosawa, Saitama 351-0198, Japan.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV epArcLight was a gift from Vincent Pieribone (Addgene plasmid # 85803 ; http://n2t.net/addgene:85803 ; RRID:Addgene_85803)
  • For your References section:

    Directed evolution of key residues in fluorescent protein inverses the polarity of voltage sensitivity in the genetically-encoded indicator ArcLight. Platisa J, Vasan G, Yang A, Pieribone VA. ACS Chem Neurosci. 2017 Jan 3. doi: 10.1021/acschemneuro.6b00234. 10.1021/acschemneuro.6b00234 PubMed 28045247