pMXs-NDUFAF5-HA
(Plasmid
#86125)
-
PurposeRetroviral vector expressing NDUFAF5-HA-IRES-Bsd
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86125 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMXs-IRES-Bsd
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNDUFAF5
-
SpeciesH. sapiens (human)
-
Entrez GeneNDUFAF5 (a.k.a. C20orf7, bA526K24.2, dJ842G6.1)
- Promoter LTR
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TACACGCCGCCCACGTGAAG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-NDUFAF5-HA was a gift from David Sabatini (Addgene plasmid # 86125 ; http://n2t.net/addgene:86125 ; RRID:Addgene_86125) -
For your References section:
Gene Essentiality Profiling Reveals Gene Networks and Synthetic Lethal Interactions with Oncogenic Ras. Wang T, Yu H, Hughes NW, Liu B, Kendirli A, Klein K, Chen WW, Lander ES, Sabatini DM. Cell. 2017 Feb 1. pii: S0092-8674(17)30061-2. doi: 10.1016/j.cell.2017.01.013. 10.1016/j.cell.2017.01.013 PubMed 28162770