Skip to main content
Addgene
Open Menu

pYPQ141-ZmUbi-RZ-Lb
(Plasmid #86197)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86197 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 86197-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 86197-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pYPQ141
  • Backbone manufacturer
    N/A
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA cloning site
  • Alt name
    Lb Cpf1 gRNA cloning site for ribozyme cleavage
  • gRNA/shRNA sequence
    gRNA scaffold only
  • Species
    Lachnospiraceae bacterium ND2006
  • Promoter Maize ubiquitin 1

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ttcccagtcacgacgttgtaaaac
  • 3′ sequencing primer catggtcatagctgtttcctg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYPQ141-ZmUbi-RZ-Lb was a gift from Yiping Qi (Addgene plasmid # 86197 ; http://n2t.net/addgene:86197 ; RRID:Addgene_86197)

  • For your References section:

    A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Tang X, Lowder LG, Zhang T, Malzahn AA, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. 10.1038/nplants.2017.18 PubMed 28211909
Related items:
Commonly requested with: