Skip to main content

Flag-nls-NgAgo-GK
(Plasmid #86435)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86435 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4000
  • Total vector size (bp) 6748
  • Modifications to backbone
    pEGFP-N1 without the eGFP
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NgAgo
  • Alt name
    Argonaute
  • Species
    Natronobacterium gregoryi
  • Insert Size (bp)
    2948
  • GenBank ID
    FORO00000000.1 AFZ73749.1
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AleI (destroyed during cloning)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer CMV_promoter_SF GTGTACGGTGGGAGGTCTAT
  • 3′ sequencing primer NgAgo_SR TACGACGAGCAGCCACAATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    We modified the nls-NgAgo-GK (78253)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-nls-NgAgo-GK was a gift from Gaétan Burgio (Addgene plasmid # 86435 ; http://n2t.net/addgene:86435 ; RRID:Addgene_86435)
  • For your References section:

    No evidence for genome editing in mouse zygotes and HEK293T human cell line using the DNA-guided Natronobacterium gregoryi Argonaute (NgAgo). Khin NC, Lowe JL, Jensen LM, Burgio G. PLoS One. 2017 Jun 13;12(6):e0178768. doi: 10.1371/journal.pone.0178768. eCollection 2017. PONE-D-16-51193 [pii] PubMed 28609472