Flag-nls-NgAgo-GK
(Plasmid
#86435)
-
PurposeExpresses a Flag tag on the N-terminal
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86435 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 6748
-
Modifications to backbonepEGFP-N1 without the eGFP
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNgAgo
-
Alt nameArgonaute
-
SpeciesNatronobacterium gregoryi
-
Insert Size (bp)2948
-
GenBank IDFORO00000000.1 AFZ73749.1
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AleI (destroyed during cloning)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer CMV_promoter_SF GTGTACGGTGGGAGGTCTAT
- 3′ sequencing primer NgAgo_SR TACGACGAGCAGCCACAATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byWe modified the nls-NgAgo-GK (78253)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Flag-nls-NgAgo-GK was a gift from Gaétan Burgio (Addgene plasmid # 86435 ; http://n2t.net/addgene:86435 ; RRID:Addgene_86435) -
For your References section:
No evidence for genome editing in mouse zygotes and HEK293T human cell line using the DNA-guided Natronobacterium gregoryi Argonaute (NgAgo). Khin NC, Lowe JL, Jensen LM, Burgio G. PLoS One. 2017 Jun 13;12(6):e0178768. doi: 10.1371/journal.pone.0178768. eCollection 2017. PONE-D-16-51193 [pii] PubMed 28609472