pLinker-AID-3xHA-HXGPRT-LoxP
(Plasmid
#86553)
-
Purposeused for a TIR1-AID system with CRISPR tagging technology in Toxoplasma gondii
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 86553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2830
- Total vector size (bp) 2830
-
Vector typeExpression in Toxoplasma gondii
-
Selectable markersHXGPR for Toxoplasma gondii
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLinker-AID-3xHA-HXGPRT 3'UTR
-
SpeciesToxoplasma gondii
-
Insert Size (bp)1287
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer attcgggcccgctagcAAGGGCTCGGGCTCGACCCAGCTGATGGGCAGTGTCGAGCT
- 3′ sequencing primer ATACCGTCGACCCTCGAGTAGAACTAGTGGATCCGAGCACGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLinker-AID-3xHA-HXGPRT-LoxP was a gift from David Sibley (Addgene plasmid # 86553 ; http://n2t.net/addgene:86553 ; RRID:Addgene_86553) -
For your References section:
Calmodulin-like proteins localized to the conoid regulate motility and cell invasion by Toxoplasma gondii. Long S, Brown KM, Drewry LL, Anthony B, Phan IQH, Sibley LD. PLoS Pathog. 2017 May 5;13(5):e1006379. doi: 10.1371/journal.ppat.1006379. PPATHOGENS-D-17-00427 [pii] PubMed 28475612