Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #86556)


Item Catalog # Description Quantity Price (USD)
Plasmid 86556 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Kristin Bernhardt
  • Backbone size w/o insert (bp) 11630
  • Total vector size (bp) 14121
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Mutation
    Cas9 is codon optimized for C. reinhardtii
  • Promoter UBIQUITIN10

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTTCGTTCGATCCCAATTTC
  • 3′ sequencing primer aagaccggcaacaggattc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Peter Hegemann, HU Berlin
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

See Hahn et al., 2017

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUB-Cas9 was a gift from Andreas Weber (Addgene plasmid # 86556 ; ; RRID:Addgene_86556)
  • For your References section:

    An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M, Weber AP. Front Plant Sci. 2017 Jan 24;8:39. doi: 10.3389/fpls.2017.00039. eCollection 2017. 10.3389/fpls.2017.00039 PubMed 28174584