Skip to main content

pEGFP-C1-AR V7
(Plasmid #86856)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 86856 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 86856-D50 50 μg of DNA in Tris buffer $495
DNA 86856-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech (Takara)
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 6642
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Sequence-verify the poly-glutamine expansion when preparing new plasmid preps. Depositor recommends screening a handful of colonies. See "Depositor Comments" for more information.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Androgen receptor (AR)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1932
  • Mutation
    Alternative splice variant 7 (alteration/deletion of the C-terminus)
  • GenBank ID
    NM_000044.3
  • Entrez Gene
    AR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xma I (not destroyed)
  • 3′ cloning site Xba I (not destroyed)
  • 5′ sequencing primer EGFP-C
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The poly-glutamine repeat region in this plasmid is known to be unstable and the exact number of repeats may vary. However, repeats of 18-26 glutamines are all considered wildtype. Screen multiple colonies to ensure isolation of a plasmid with a suitable number of repeats.

Prostate. 2013 February 15; 73(3): 267–277. doi:10.1002/pros.22566. The activity of the androgen receptor variant AR-V7 is regulated
by FOXO1 in a PTEN-PI3K-AKT-dependent way.

Cloning is described in the supplemental materials (excerpted below).

Cloning Strategy
The carboxy-terminal part of AR-V7 and AR-V1 were PCR amplified by using the following primers: sense (common for AR-V1 and AR-V7 amplification) 5’-GCGCAAGCTTCTGGGTGTCACTATGGAGC (harboring a Hind III site), antisense for AR-V7 GCTCTAGATCAGGGTCTGGTCATTTTGAGATGC (harboring a XbaI site), antisense for AR-V1 GCTCTAGATTAAGGAAGCCATTCTGAGACTCC (also harboring a XbaI site). CMV-AR-V7 and CMV-AR-V1 were generated by replacing a HindIII-XbaI cDNA fragment encoding the carboxy-terminal portion of wild-type AR (subcloned into a pcDNA3 plasmid) with the AR-V7 or AR-V1 fragments generated by PCR. GFP-AR-V7 and GFP-AR-V1 were generated by replacing an XmaI-XbaI cDNA fragment encoding the carboxy-terminal part of wild-type AR, subcloned in frame to the green fluorescent protein of plasmid pEGFP-c1, with XmaI-XbaI fragments from the pcDNA3 plasmids containing the AR-V7 and AR-V1 variants.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-AR V7 was a gift from Michael Mancini & Marco Marcelli (Addgene plasmid # 86856 ; http://n2t.net/addgene:86856 ; RRID:Addgene_86856)
  • For your References section:

    High-Content Screening Identifies Src Family Kinases as Potential Regulators of AR-V7 Expression and Androgen-Independent Cell Growth. Szafran AT, Stephan C, Bolt M, Mancini MG, Marcelli M, Mancini MA. Prostate. 2017 Jan;77(1):82-93. doi: 10.1002/pros.23251. Epub 2016 Oct 4. 10.1002/pros.23251 PubMed 27699828