pAAV-Ai14-HITI
(Plasmid
#87117)
-
PurposeAAV backbone plasmid including GFPNLS-pA knock-in donor and Ai14gRNA for HITI
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 87117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonePX551
-
Backbone manufacturerAddgene 60957
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6-Ai14sgRNA-GFPNLS-EF1a-mCherryKASH-pA
-
gRNA/shRNA sequenceGAGGAACTTCTTAGGGCCCG
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
There is 11bp deletion in left ITR, which is from original backbone plasmid (i.e. PX551). We don't believe it interfered with packaging.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ai14-HITI was a gift from Juan Belmonte (Addgene plasmid # 87117 ; http://n2t.net/addgene:87117 ; RRID:Addgene_87117) -
For your References section:
In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, Hatanaka F, Yamamoto M, Araoka T, Li Z, Kurita M, Hishida T, Li M, Aizawa E, Guo S, Chen S, Goebl A, Soligalla RD, Qu J, Jiang T, Fu X, Jafari M, Esteban CR, Berggren WT, Lajara J, Nunez-Delicado E, Guillen P, Campistol JM, Matsuzaki F, Liu GH, Magistretti P, Zhang K, Callaway EM, Zhang K, Belmonte JC. Nature. 2016 Dec 1;540(7631):144-149. doi: 10.1038/nature20565. Epub 2016 Nov 16. 10.1038/nature20565 PubMed 27851729