-
PurposeFluorescent protein targeted to lipid droplets (LDs) from the endoplasmic reticulum (ER)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 87158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEFIRES-P
- Backbone size w/o insert (bp) 5689
- Total vector size (bp) 8577
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameACSL3
-
Alt nameACS3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2160
-
GenBank IDNM_203372.1
-
Entrez GeneACSL3 (a.k.a. ACS3, FACL3, LACS 3, LACS3, PRO2194)
- Promoter EF-1-alpha
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pEF-forward tctctccacaggtgtccact
- 3′ sequencing primer mCherry-R TTGGTCACCTTCAGCTTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector was generated by Shiqian Li (Elina Ikonen Lab).
Benefits of using pEFIRES-P vector for stable overexpression in mammalian cells were described by Stephen Hobbs et al. (Biochem Biophys Res Commun. 1998 Nov 18;252(2):368-72.).
pEFIRES-P was a gift from Dr. Olli Ritvos (University of Helsinki).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEFIRES-P-ACSL3-mCherry was a gift from Elina Ikonen (Addgene plasmid # 87158 ; http://n2t.net/addgene:87158 ; RRID:Addgene_87158) -
For your References section:
Seipin regulates ER-lipid droplet contacts and cargo delivery. Salo VT, Belevich I, Li S, Karhinen L, Vihinen H, Vigouroux C, Magre J, Thiele C, Holtta-Vuori M, Jokitalo E, Ikonen E. EMBO J. 2016 Dec 15;35(24):2699-2716. Epub 2016 Nov 22. 10.15252/embj.201695170 PubMed 27879284