pHES840
(Plasmid
#89191)
-
PurposeExpresses YFP under control of GAL1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89191 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepNH605
- Backbone size w/o insert (bp) 7366
- Total vector size (bp) 8685
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepGAL1-YFP
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)1391
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PspOMI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TATTAGCTTGTGCATTCGCAT
- 3′ sequencing primer CGCACTCACGTAAACACTTAATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHES840 was a gift from Hana El-Samad (Addgene plasmid # 89191 ; http://n2t.net/addgene:89191 ; RRID:Addgene_89191) -
For your References section:
Robust Synthetic Circuits for Two-Dimensional Control of Gene Expression in Yeast. Aranda-Diaz A, Mace K, Zuleta I, Harrigan P, El-Samad H. ACS Synth Biol. 2016 Dec 27. doi: 10.1021/acssynbio.6b00251. 10.1021/acssynbio.6b00251 PubMed 27930885