DNA-CARzeta-GFP
(Plasmid
#89344)
-
Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFP
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8311
- Total vector size (bp) 10767
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNA-CARzeta
-
Alt nameSignal-Peptide-SNAPf tag- TM-CD3zeta chains fused in frame to mGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1803
-
Entrez GeneCD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
-
Entrez GeneCD86 (a.k.a. B7-2, B7.2, B70, CD28LG2, LAB72)
-
Tags
/ Fusion Proteins
- SNAPf tag (N terminal on insert)
- mEGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Mlu1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer SFFV for (GCTTCCCGAGCTCTATAAAAGAGC)
- 3′ sequencing primer GFP rev, WPRE rev (CCAGAGGTTGATTATCGATAAGC) (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DNA-CARzeta-GFP was a gift from Ron Vale (Addgene plasmid # 89344 ; http://n2t.net/addgene:89344 ; RRID:Addgene_89344) -
For your References section:
A DNA-Based T Cell Receptor Reveals a Role for Receptor Clustering in Ligand Discrimination. Taylor MJ, Husain K, Gartner ZJ, Mayor S, Vale RD. Cell. 2017 Mar 23;169(1):108-119.e20. doi: 10.1016/j.cell.2017.03.006. 10.1016/j.cell.2017.03.006 PubMed 28340336